Review



grb2 3972s  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc grb2 3972s
    Grb2 3972s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 257 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grb2 3972s/product/Cell Signaling Technology Inc
    Average 95 stars, based on 257 article reviews
    grb2 3972s - by Bioz Stars, 2026-05
    95/100 stars

    Images



    Similar Products

    lentiviral particles carrying shrna targeting grb2  (Genechem)
    86
    Genechem lentiviral particles carrying shrna targeting grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Lentiviral Particles Carrying Shrna Targeting Grb2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral particles carrying shrna targeting grb2/product/Genechem
    Average 86 stars, based on 1 article reviews
    lentiviral particles carrying shrna targeting grb2 - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    grb2 immunohistochemistry  (Human Protein Atlas)
    86
    Human Protein Atlas grb2 immunohistochemistry
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2 Immunohistochemistry, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grb2 immunohistochemistry/product/Human Protein Atlas
    Average 86 stars, based on 1 article reviews
    grb2 immunohistochemistry - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    stable cell lines lentiviral particles carrying shrna targeting grb2  (Genechem)
    86
    Genechem stable cell lines lentiviral particles carrying shrna targeting grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Stable Cell Lines Lentiviral Particles Carrying Shrna Targeting Grb2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stable cell lines lentiviral particles carrying shrna targeting grb2/product/Genechem
    Average 86 stars, based on 1 article reviews
    stable cell lines lentiviral particles carrying shrna targeting grb2 - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    anti grb2  (Proteintech)
    93
    Proteintech anti grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Anti Grb2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti grb2/product/Proteintech
    Average 93 stars, based on 1 article reviews
    anti grb2 - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    grb2 3972s  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc grb2 3972s
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2 3972s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grb2 3972s/product/Cell Signaling Technology Inc
    Average 95 stars, based on 1 article reviews
    grb2 3972s - by Bioz Stars, 2026-05
    95/100 stars
    		  Buy from Supplier
    grb2  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grb2/product/Cell Signaling Technology Inc
    Average 95 stars, based on 1 article reviews
    grb2 - by Bioz Stars, 2026-05
    95/100 stars
    		  Buy from Supplier
    k ras  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology k ras
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    K Ras, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/k ras/product/Santa Cruz Biotechnology
    Average 96 stars, based on 1 article reviews
    k ras - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    grb2  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grb2/product/Santa Cruz Biotechnology
    Average 96 stars, based on 1 article reviews
    grb2 - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Expressing, Immunohistochemistry

    Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Expressing, Biomarker Discovery

    Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Expressing

    PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Western Blot, CCK-8 Assay, Flow Cytometry

    Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Stable Transfection, CCK-8 Assay, Flow Cytometry

    GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Expressing, Immunohistochemistry

    Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Expressing, Biomarker Discovery

    Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Expressing

    PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Western Blot, CCK-8 Assay, Flow Cytometry

    Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Stable Transfection, CCK-8 Assay, Flow Cytometry